Blog
Covid-19 Virus Illustration
The coronavirus pandemic has kept us inside since March, but one positive effect is that it has created time for me to work on some projects of my own and to learn some new skills. I’ve spent a good bit of my quarantine time learning to use the open-source 3D software, Blender, and I love it! I know that there are already a lot of fantastic images of this virus out there, but it seemed appropriate to make my own model and illustration of the Covid-19 virion that is responsible for this little interruption in our regularly scheduled life on Earth. Blender’s cloning and instancing tools are well suited to the task of replicating the thousands of detailed parts which make up something like a virus particle. Each model virion in this image contains about 80 spike proteins, 240 membrane and envelope proteins, and 120,000 lipids!
In this render I’m imagining the sun setting on the virus, as we begin to return to the world outside. Although I know we have a way to go yet, some day we will be able to put Covid-19 behind us and get on with our lives. Stay safe!
3D Animator Helps Fight the Zika Virus
John Liebler’s curiosity and interest in creating a 3D model of the Zika Virus inspired Dr. Sean Ekins, CEO, Collaborations Pharmaceuticals, Inc. to try to model every protein in the Zika virus…which directly led to writing a groundbreaking paper with homology models of all the proteins of the Zika virus. (Homology models, which are computational, three-dimensional renderings of proteins within an organism, are useful when the structure of a protein is not experimentally known, which is the case with the Zika virus.)”
The article below was originally published Dr. Carolina Horta Andrade here.
Help an International Research Team Fight the Zika Virus
By: Dr. Carolina Horta Andrade
Universidade Federal de Goiás, Brazil
19 May 2016The Zika virus was relatively unknown until 2015, when it made headlines due its rapid spread and its link to severe brain-related deficiencies in newborns born to mothers who contracted the virus while pregnant. Dr. Carolina Horta Andrade, the principal investigator for the new OpenZika project, discusses how she and an international team of researchers are using World Community Grid to accelerate the search for an effective anti-Zika treatment.
Dr. Carolina Horta Andrade, principal investigator for OpenZika
IntroductionFew people had heard of the Zika virus before 2015, when it began rapidly spreading in the Americas, particularly in Brazil. The virus is mostly spread by Aedes aegypti mosquitoes, although sexual and blood transmission are also possible. A currently unknown percentage of pregnant women who have contracted the Zika virus have given birth to infants with a condition called microcephaly, which results in severe brain development issues. In other cases, adults and children who contract the Zika virus have suffered paralysis and other neurological problems.
Currently, there is no treatment for the Zika virus and no vaccine. Given that Zika has quickly become an international public health concern, my team and I are working with researchers here in Brazil as well as in the United States to look for possible treatments, and we are using World Community Grid to accelerate our project.
Background
The world has become increasingly alarmed about the Zika virus, and with good reason. Until recently there has been little research on this disease, but in the past few months it has been linked to severe brain deficiencies in some infants as well as potential neurological issues in children and adults. As a scientist and a citizen of Brazil, which has been greatly affected by Zika, I am committed to the fight against the virus, but my team and I will need the help of World Community Grid volunteers to provide the massive computational power required for our search for a Zika treatment.
I am a professor at the Universidade Federal de Goiás (UFG) in Brazil, and the director of LabMol, a university laboratory which searches for treatments for neglected diseases and cancer. My field is medicinal and computational chemistry, with an emphasis on drug design and discovery for neglected diseases. I first became interested in working in this area because these are diseases that do not interest pharmaceutical companies, since they mainly affect marginalized populations in underdeveloped and developing countries. However, these diseases are highly debilitating and, for most of them, there is no adequate drug treatment. Brazil is vulnerable to a number of neglected diseases, such as dengue, malaria, leishmaniasis, schistosomiasis, and others. My greatest desire is to find treatments to improve the lives of thousands of people throughout the world who suffer from these diseases.
In 2015, I started a project in collaboration with Dr. Sean Ekins, a pharmacologist with extensive research experience, to focus on the development of computational models to identify active compounds against the dengue virus, which is a serious mosquito-borne disease found throughout the world. These active compounds could become candidates for antiviral drugs. We are now at the stage of selecting compounds to start laboratory tests. In January of 2016, when the Zika virus outbreak in Brazil became alarming, Sean and I decided to expand our dengue research, and we included the Zika virus in our work, since these two diseases are from the same family of viruses.
Dr. Sean Ekins, CEO, Collaborations Pharmaceuticals, Inc.
Sean invited me and other collaborators to write a perspective paper that was published in the beginning of 2016, about the need for open drug discovery for the Zika virus. This work grabbed the attention of scientific illustrator John Liebler, who wanted to produce a picture of the complete Zika virion. We are using the illustration he created (shown below) as a visual for the OpenZika project.
Image copyright John Liebler, www.ArtoftheCell.com. All rights reserved. Used by permission.
John’s interest inspired us to try to model every protein in the Zika virus, which directly led to writing a groundbreaking paper with homology models of all the proteins of the Zika virus. (Homology models, which are computational, three-dimensional renderings of proteins within an organism, are useful when the structure of a protein is not experimentally known, which is the case with the Zika virus.)The OpenZika Research Team
After Sean and I began our work on the Zika virus, he introduced me to World Community Grid. Sean has also collaborated with Dr. Alexander Perryman of Rutgers University, New Jersey Medical School, who was previously at The Scripps Research Institute where he played a key role in two World Community Grid projects: Fight AIDS@Home and GO Fight Against Malaria. Sean and Alex are both co-principal investigators with me on the OpenZika project.
Dr. Alexander Perryman, co-primary investigator, and Dr. Joel Freundlich, collaborator, Rutgers University New Jersey Medical School
The research team also includes my colleagues at UFG, Dr. Rodolpho Braga, Dr. Melina Mottin and Dr. Roosevelt Silva; Dr. Jair L. Siqueira-Neto from University of California, San Diego; and Dr. Wim Degrave of the Oswaldo Cruz Foundation in Brazil, who is already working with World Community Grid on the Uncovering Genome Mysteries project, among others.
The UFG team includes Dr. Rodolpho Braga, Dr. Carolina Horta Andrade, Dr. Melina Mottin and Dr. Roosevelt Silva (not pictured).
This large group of collaborators means that the team has every set of skills and experience necessary to conduct this research end-to-end, as some of the researchers are computational modeling experts while others have extensive laboratory experience.Our Goals
The OpenZika project on World Community Grid aims to identify drug candidates to treat the Zika virus in people who have been infected. The project will use software to screen millions of chemical compounds against the target proteins that the Zika virus likely uses to survive and spread in the human body, based on what is known from similar diseases such as dengue virus and yellow fever. As science’s knowledge of the Zika virus increases in the coming months and key proteins are identified, the OpenZika team will use the new knowledge to refine our search.
Our work on World Community Grid is only the first step in the larger project of discovering a new drug to fight the Zika virus. Next, we will analyze the data obtained from World Community Grid’s virtual screening to choose the compounds that show the most promise. After we have selected and tested compounds that could be effective in killing the Zika virus, we will publish our results. As soon as we have proven that some of the candidate compounds can actually kill or disable the virus in cell-based tests, we and other labs can then modify the molecules to increase their potency against the virus, while ensuring that these modified compounds are safe and non-toxic.
We are committed to releasing all the results to the public as soon as they are completed, so other scientists can help advance the development of some of these active compounds into new drugs. We hope that OpenZika will include a second stage, where we can perform virtual screenings on many more compounds.
Without this research–and other projects that are studying the Zika virus–this disease could become an even bigger threat due to the rapid spread of the virus by mosquitoes, blood and sexual transmission. The link between the Zika virus in pregnant women and severe brain-based disorders in children could impact a generation with larger than usual numbers of members who have serious neurological difficulties.
And without the resources of World Community Grid, using only the resources of our lab, we would only be able to screen a few thousand compounds against some of the Zika proteins, or it would take years to screen millions of compounds against all Zika proteins. This would severely limit our potential for drug discovery.
Enlisting the help of World Community Grid volunteers will enable us to computationally evaluate over 20 million compounds in just the initial phase (and potentially up to 90 million compounds in future phases). Thus, running the OpenZika project on World Community Grid will allow us to greatly expand the scale of our project, and it will accelerate the rate at which we can obtain the results toward an antiviral drug for the Zika virus.
By working together and sharing our work with the scientific community, many other researchers in the world will also be able to take promising molecular candidates forward, to accelerate progress towards defeating the Zika outbreak.
To contribute to OpenZika, join World Community Grid, or if you are already a volunteer, make sure the project is selected on your My Projects page.
This article is also available in Spanish and Portuguese.
#zika #zikavirus #openzika #virus #medicalillustration #scientificillustration
Zika/Dengue Virus Comparison gif
As a follow-up to yesterday’s post about the structure of the Zika virus envelope, here is an animated gif overlaying the Dengue Virus envelope structure with the homology model of the Zika Virus structure.
Will the real Zika virus please stand up?
We’ve seen a lot of news coverage recently of the ZIka virus. The World Health Organization has declared Zika a Global Emergency and scientists from around the world are collaborating, sharing information to help combat the disease. Zika is a mosquito-borne flavivirus which is becoming a pandemic in many parts of the world. It has possible links to birth defects in the fetuses of pregnant women with Zika fever and neurological conditions in infected adults. I became interested in creating a picture of the virus, but discovered that the structure is unresolved. A little digging on the internet turned up several pictures of the virus that were actually pictures of a similar virus, the Dengue virus. Although it is a common practice for scientific artists to substitute similar structures, I wanted to see if I could do better.
I found a homology model of the Zika envelope protein created by Dr Sean Ekins as part an opinion article uploaded to f1000research.com and contacted him about it. A homology model applies the amino acid structure of an unknown protein (in this case Zika) to the known structure of a similar protein or proteins (in this case Dengue and Japanese Encephalitis) in an attempt to predict the structure of the new protein. As a result of Dr Ekin’s efforts, I have created this image of the Zika virus envelope, using his homology models arranged with the structural organization of the Dengue virus. I hope that through their combined efforts, scientists are able to provide more detailed structures of the Zika virus, not for the sake of picture-makers like me, but to understand and ultimately overcome this disease.
For comparison’s sake, here is the same image rendered with the Dengue envelope protein. They are very similar, but several differences can be observed.
#zika #zikavirus #openzika
For licensing information, click here.
Ukulele Acquisition Syndrome
Happy Holidays!
When I’m supposed to be not hard at work creating molecular and cellular art, I can often be found playing the ukulele. Studies have shown that playing the ukulele dramatically increases the risk of UAS, or Ukulele Acquisition Syndrome. UAS manifests itself in the insatiable need to own “just one more” ukulele. Here, envisioned for the first time, is the viral capsid of this insidious disease. The UAS virion is similar in appearance to that of Guitar Acquisition Syndrome but it is smaller and carries two fewer strands of viral RNA. Despite similarities, sufferers of UAS are quick to point out that UAS is not merely a smaller or “toy” version of GAS.
Symptoms of UAS infection include:
- Playing the ukulele
- Continuing to play the ukulele even after being asked to stop
- Searching eBay for the term “ukulele” more than once per hour
- Saying “I’m only going to buy this one, and maybe one more, then I’m done…”
or “I need one of these because it has a different tuning/headstock/woodgrain pattern than my others…”
Although the symptoms of UAS can be moderated in some cases, through the application of strings, tuners, or other ukulele accessories, There. Is. No. Cure.
🙂 Happy, Happy, Joy! Joy! See you in the New Year!
Get your very own Ukulele Acquisition Syndrome T-Shirt on Red Bubble. >>
Art of the Cell T-shirts Posters and Prints
Want a print or t-shirt of your favorite scientific cell, virus or molecule?
Through the magic of the internet (Ok, actually it’s Redbubble) , we are now able to offer many Art of the Cell images on T-shirts, posters, prints, and a variety of other products. The scarves and duvet covers are actually pretty neat. 🙂 Check them out, here!
Antibody, Red, White, and Blue
Scientific Illustration of Antibody | Art of the Cell
Another scientific illustration of an antibody. I’m gearing up for a medical animation involving antibodies, and experimenting with new looks and ideas to make it look different from the antibodies I’ve done before. This one uses Van Der Waals spheres to describe the protein, and kind of a darker, moodier atmosphere. I like it. 🙂 I think this one would make a good wallpaper, so I’ll probably add it to that page as well. In the meantime, if you need a specific size to fit your screen, let me know, and I’ll hook you up.
And don’t worry, Van Der Waals surface fans, I’ve got one like that coming up real soon. 🙂
• To license a scientific antibody illustration for commercial use, please see our gallery/pricing page for more information.
#antibody #virus #scientific #illustration #medicalstock
A STEP in the Right Direction: Scientific Animation
This (blue) protein is STtriatal-Enriched tyrosine Phosphatase, or STEP. Increased STEP levels are found in several genetic brain disorders, such as Alzheimer’s, Parkinson’s, schizophrenia, and fragile X syndrome.
Discovered by Dr. Paul Lombroso, STEP triggers the removal of receptors from the synapses of brain cells. This is part of the ordinary regulation of the synapse, but too much STEP can lead to the over-removal of receptors, impairing the brain’s ability to form new memories.
We are wrapping up a new animation that explains the activity of STEP and Dr. Lombroso’s work, which I will post here soon, but in the meantime here are a few more stills from the production.
Alcohol Dehydrogenase | Molecular Illustration
The first person to correctly identify the New Years Eve mystery molecule was James Tyrwhitt-Drake. He was (very) quick to recognize Alcohol Dehydrogenase, an enzyme that converts alcohol (ethanol) into acetaldehyde in the liver and stomach lining, which, for many of us, is especially important on New Years Eve. Interestingly, some plants, bacteria, and yeast have Alcohol Dehydrogenases that do the opposite, and produce alcohol. A nifty trick which we exploit to make the beverages which we then consume and process with our own Alcohol Dehydrogenases. Ahh… the circle of life.
James will be receiving a signed 4″x6″ artist’s proof metal print of the Cas9 CRISPR complex from last June. By the way, if you like the images on this blog, you will love the stuff James posts on his blog, Infinity Imagined. You could (and should) spend the rest of the day trawling the archive of amazing images there. James also has a Youtube channel, here, and some incredible Gigapans, here. Go check them out!
Inside a Neuron by James Tyrwhitt-Drake. Zoom in with your scroll wheel. and in, and in and in some more…
Happy New Year! Scientific Illustration
As we ring out 2014, and welcome the new year, here’s a puzzle for you. Be the first to identify the molecules pictured above, and you’ll win an Art of the Cell prize!
Hint: they’re probably quite busy this time of year. 🙂
So leave a comment, send an e-mail, or tie a scrap of paper to an owl with your guess. I’ll post the answer in a few days.
Cheers!
Vitamin Z? Scientific Illustration GIF
This is tryptophan. OK, it’s not a vitamin, it’s an essential amino acid that we get from food. You may have heard that it makes you sleepy, and it actually can help you sleep, but probably not in the way that you’ve heard.
No Thanksgiving dinner is complete without some uncle or cousin informing the gathering that the Turkey they are eating is loaded with tryptophan, and that it functions as a sort of knock-out drug to make us all collapse on soft furniture after dinner. Not quite.
First off, tryptophan levels in turkey are the same as in chicken and most other meat. Egg whites have about four times as much tryptophan, and we eat them for breakfast!
However, Postprandial Somnolence (which, apart from being an excellent name for a long lost Emerson Lake and Palmer album, is a sciencey way to say afterdinner sleepies) is a real thing, and tryptophan does play a part. But do you know what else plays a part? Pie. And mashed potatoes, and rolls, and all of the other carbohydrates you eat with the turkey. The carbs trigger the release of insulin, which stimulates the uptake of other amino acids into the muscles, leaving an increased level of tryptophan in your blood that can then be absorbed into the brain. The tryptophan is converted to serotonin, the serotonin is metabolized into melatonin, and, it’s the melatonin that makes us sleepy.
I got sleepy just writing that last paragraph. You too? Go ahead, take a little nap.
When you wake up, there will be leftovers in the kitchen, and maybe one more slice of pie?
New Virus Discovered: Scientific Illustration GIF
A newly discovered virus could be affecting most of the population in the late days of October into early November this year. In it’s early stages the virus can completely change the behavior and appearance of the affected, and spreads as the victims travel from house to house in this new persona gathering more infection as they go. “Children are the most susceptible, although secondary infections in adults are common in the days following an outbreak” says Dr. Candace Korne of the CDC (Center for the Distribution of Candy). Dr Korne goes on to say, however, that the virus is not life threatening, but can lead to moderate weight gain and tooth decay.
Happy Halloween!
My first attempt at a “stereo” gif. Seems a bit jittery, but considering the sugar content of the subject matter, maybe that’s to be expected.
RNA Polymerase Transcription: Scientific Illustration GIF
In Autumn, the proteins in our cells, change colors and put on a fantastic display before they flutter softly to the ground… no wait, that’s leaves. Nonetheless, this RNA polymerase sports the latest fall colors, inspired by the view from my windows. RNA Polymerases create strands of RNA from a DNA template in the nucleus. The RNA can go on to be used in the process of protein translation outside the nucleus. Sadly, cellular proteins are too small to actually have any color at all; the wavelengths of visible light are much larger, but at least we don’t have to rake them.
And here it is in animated GIF form:
Video: Watch our updated demo reel of medical and scientific animation.
Beneath our everyday world there is a miniature universe of cells, trillions of tiny worlds, unseen and beautiful. Here is the latest Art of the Cell demo reel, including clips from many of the projects I have worked on, such as “Biology:How Life Works”, and “The Inner Life of the Cell”. In this video compilation, you will glimpse transport molecules strutting through the cellular landscape, watch antibodies mark cancer cells for destruction, view viral rna enclosed in geometric capsids, and witness apoptosomes gathering in a cell’s final hour. Look on as spinning atp synthases generate power deep in the folds of mitochondria, observe chromosomes divide as a cell undergoes mitosis, and see signals amplified as they cascade through the cytosol. I hope that you enjoy this two and a half minute tour of the Art of the Cell.
Scientific Illustrations on your Desktop
3D Molecular Wallpapers
According to a recent study of the teenagers who live in my house, most people’s home screen savers are “disappointing”. In an effort to combat this serious world issue, we have formatted some of our popular molecular images to fit the laptops, phones, tablets and whatever other glowing fields of pixels you stare at all day. So, put apoptosomes on your iphone, or tRNA on your tablet, or parvovirii on every computer in the lab. Download from the Wallpapers Page, or click on a link below.
We’ve tried to cover pixel dimensions for the most common devices and screen resolutions, but if you don’t see what you’re looking for, drop us a note, and we can probably get you the size you need. Enjoy!
Here you will find a selection of our popular stills, in convenient downloadable wallpaper formats. We’ve tried to cover pixel dimensions for the most common devices and screen resolutions, but if you don’t see what you’re looking for, drop us a note, and we can probably get you the size you need. Enjoy!
Acetylcholinesterase
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Apoptosome
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Bacteriorhodopsin
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
CRISPR Cas9 System
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
DNA
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Parvovirus
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Pariacoto Virus (PaV)
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
tRNA
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Unwinding DNA
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
Voronoi Shperes
Right-click on a size below and choose “Save Link As…”:
2048 x 1536 (iPad)
1920 x 1200 (widescreen monitor)
1920 x 1080 (standard HD)
640 x 1136 (iPhone 5)
320 x 480 (pre-iPhone5)
One More Cup of Coffee: Scientific Illustration
These yellow structures are adenosine A2A receptors in the shell of the nucleus accumbens of the brain. As we become tired, our bodies produce adenosine (the green small molecule above), which binds to these receptors and they, in turn, send signals to inhibit arousal. In other words, we get sleepy. Enter caffeine! (the orange small molecule above). Caffeine binds to the A2A receptors in place of adenosine and blocks the process, so we wake up.
There have been a lot of good caffeine related stories on the internet this week. Check out Carl Zimmer’s article in the New York Times about how plants evolved to make caffeine. Or watch this video from ASAP Science, doing an excellent job of explaining how caffeine works using fun whiteboard cartoons. Or read this article on BoingBoing in which Dr Kiki Sanford considers the option having an electric current passed through her brain in place of her daily cup of Joe.
But, maybe you better pour yourself another cup of coffee first.
See the Light: Scientific Illustration
Bacteriorhodopsin is a protein found in archaeal cells. It uses the energy from light to pump protons across the cell membrane. The resulting proton gradient is used to drive the ATP making machinery that powers the cell. Our eyes have a similar light sensitive protein called rhodopsin in their retinas. Rhodopsins have seven trans-mebrane helixes and contain a molecule of retinal which triggers the protein when it absorbs a photon of light.
Although bacteriorhodopsin has a different natural function than the rhodopsin found in our eyes, research is being done to see if the proton gradient it creates from light can be used to stimulate the cells in damaged retinas, and restore sight. LambdaVision is a Connecticut based company which is developing a retinal implant made from bacteriorhodopsin for patients suffering from degenerative retinal diseases. I’ve seen the effects of macular degeneration in my family, and it is good to know that this debilitative disease may soon be treatable with bacteriorhodopsin.
Release Your Inhibitions: Scientific Illustration Acetylcholine
This (the green protein) is acetylcholinesterase. It is found in the space between neural synapses. The small blue guys are acetylcholine neurotransmitters, and are released from the pre-synaptic membrane of one neuron, and received by acetycholine receptors on the post-synaptic membrane of the next neuron, passing on the signal. acetylcholinesterase breaks down the acetylcholine in the synapse, and terminates the neurotransmission. The Red molecule is Donepezil, which is sometimes used to improve cognition in Alzheimer’s patients by inhibiting the acetylcholinesterase.
Donepezil is a reversible inhibitor which means that it is broken down in a few hours, and is useful for neural regulation. Other non-reversible inhibitors, such as those found in snake venom, take days to break down and can cause paralysis or asphyxiation. Another reversible inhibitor of acetylcholinesterase is tetrahydrocannibinol, or THC, the main psychoactive ingredient in cannabis.
I used pdb 4EY7 to model the Acetylcholinesterase.
That’s No Moon…Scientific Illustration
This star-shaped protein complex is called an apoptosome, and it is constructed in cells to bring about cell death. It’s actually part of a cell’s self-destruct system. When a cell becomes stressed or old, and ceases to function properly, a series of signals bring about apoptosis, or programmed cell death. This is a good thing, and part of the natural life cycle of a cell. Unfortunately, this process can be blocked in cancer cells, preventing your immune system from killing them off.
In this image (derived mostly from pdb 3j2t) , cytochrome C (the blue guys) have bound to Apaf-1 (the orange guys), prompting them to form apoptosomes. The apoptosomes will then begin a cascade of Caspase activations which will end in the destruction of the cell’s organelles, and ultimately the cell itself.
Tutorial: Make molecules in PyMOL for Lightwave3D
Medical and scientific animations frequently require the display of molecular models from PDB (Protein Data Bank) files. Until we get access to ePMV the options for Lightwave users are Sean Moyer’s PDB reader (which, unfortunately, inverts models on their Z axis), or an external molecular viewing software.
My viewer of choice is PyMOL. PyMOL is a molecular visualization viewer, built on open-source software. There is a subscription version, which includes support and some extra features, but for just exporting models for use in Lightwave, the pre-compiled open source version (described here) will work just fine. There are thousands (millions?) of known structures available in the PDB Database, and figuring out which one to use, or which parts of it to use is a dark art unto itself. For the purpose of this tutorial, we will be making hemoglobin from the file:
Here’s mine on Sketchfab.
Ok, let’s get started. Open PyMOL (if you need to install PyMOL, follow the instructions, here). Two windows will open: a viewer and a text window, with a bunch of menus and buttons.
In the command line at the bottom of the text window, type the following command
fetch 4hhb
PyMOL will fetch the pdb file and display a line version of the molecule. Cool!
now, type the command
split_chains
In the list on the right side of the viewer, you will see four new entries, corresponding to the separate parts of this structure. If you don’t want separate parts, you can skip this step, but split_chains is a very useful command, especially when you get to animating and surfacing.
You can toggle the pieces on and off in the list, and each of the letters accesses a drop-down menu of choices. The letters stand for Actions, Show, Hide, Label, and Color. You can have a play with them later, for now onward!
Click the H for the “all” entry at the top of the list and choose Hide: everything. The molecule will disappear. Surprise. Now click the S and choose Show: surface.
And that’s what it looks like if you run a pocketful of skittles through the dryer. Seriously, the default color scheme is hard to look at. If you want to save your eyes, click the C button for “all” and choose something else. a nice gray perhaps? Aaahhh, that’s better.
It doesn’t really matter what color you choose, since the model will be surfaced in Lightwave (or whatever other collection of 3D code you prefer to bang your head against.)
If the model in the viewer is what you want, then you are ready to export, but let me show you a few things first. Under the “Display” menu in the text field, there is a sub-menu for “Quality”. Try each of the settings and see what it looks like. “Maximum quality” looks nice, but is a super-dense mesh. The default is “reasonable quality” and is just what it says on the tin.
Another way to change the model’s appearance is to change the “Solvent Radius”
type:
set solvent_radius, .5
in the text field. This changes the size of the balls which represent the atoms of the molecule, and is kind of a “season to taste” thing.
Now reset the solvent radius to 1 or so (the default is 1.4, I think).
Finally, to save your model as an.obj, type:
save Hemoglobin.obj
and PyMOL will export an obj of the model to the directory where the pdb is stored (in this case, since we used the fetch command, it’s in the program directory where PyMOL is installed) You can add a path name to the front of the file name if you like,
such as:
save C:\Users\John\Desktop\Hemoglobin.obj
but I never do. 🙂
Now you can open the .OBJ in Modeler. There are all sorts of things you can do now, but you should always merge points (it will be all unwelded) and change the surface to get rid of that weird shiny .obj surface that it comes in with. Depending on how the model will be used, it might be a good idea to reduce its polygons. (this model came in at 113,000 polys!) This can be as simple as running Qemloss, or as complicated as bringing it into a sculpting program and retopologizing, but I leave that to you.
And that’s a basic PyMOL to Lightwave workflow. You can find lots more information on PyMOLWiki, and there are a few more tricks and tips, for more advanced uses that I may address in the future, if there is interest. So if you have any questions or comments, please let me know. Or share you own tips in the comments.
Cheers!
Dodecahedral RNA: Scientific Illustration
Pariacoto Virus (PaV) is a nodavirus with a dodecahedral cage of RNA inside an icosahedral capsid. PaV infects insects. This one came from a Peruvian armyworm. Really. A viral structure like this just compels me to model and render it. That’s not weird is it?
If you want to explore the structure yourself, the PDB is number is 1F8V.
Time to VEG(F): Scientific Illustration
We’re making great strides here at Art of the Cell, but most of the growth is behind the scenes for now. Speaking of growth, this is VEGF which stands for Vascular Endothelial Growth Factor. VEGF is a signalling protein that stimulates the growth of new blood vessels when we grow or heal. Unfortunately, over expression of VEGF can contribute to disease. For instance cancer cells can express VEGF to grow new blood supply lines to tumors. Anti-VEGF therapies are an important treatment for many cancers.
Unwinding DNA: Scientific Illustration
Since I started exploring CRISPRs and Cas9, I’ve been spending a bit of time working out the mechanics of animating strands of DNA for my Cas9 complexes to edit. DNA is a common character in medical animations, and we are frequently called on to manipulate it in various ways. Winding, unwinding, partially unzipping, cutting, splicing, etc, and these activities can be a challenge to rig in animation software. There is a lot more information about rigging 3D characters out there than there is about rigging a strand of DNA (Google it and see), so there is always room for experimentation.
Lightwave3D has a somewhat unknown plug-in for making DNA (It’s in the “Additional” menu and is called, cleverly enough, “DNA”),and it’s pretty cool. You can actually plug in a DNA sequence (ACAAGATGCCATTGTCCCCCGGCCTCCT…etc) and get an accurate ball and stick model of it. Getting the model to move the way you want it to, well, that’s where the Dark Arts come in…
I took a moment from my incantations experimentation to make a render of some of the DNA models I’ve been abusing working on. I think it’s the DNA for summer wine grape soda. 🙂
CRISPR Cas9 Gene Editing: Scientific Illustration
A guy came up to me at a party last weekend, and asked, “Hey, do you know about CRISPRs?” and I thought, “Sure, I know how to keep my vegetables fresh in the fridge.” But, as my new friend explained, CRISPR is an acronym for: Clustered Regularly Interspaced Short Palindromic Repeats, which is an excellent excuse for an acronym.
The CRISPR Cas9 system is used to target and edit specific areas of the genome. The way it works is that a short piece of RNA which matches the section or DNA we want to target is attached to an endonuclease (Cas9). The endonuclease can then locate the matching bit of DNA and then cut both strands of the DNA at that point. This can either disrupt the gene, turning it off, or allow entirely new sequences to be appended to the genome.
This render is based on the crystal structure of Cas9 in Complex with Guide RNA and Target DNA (pdb 4oo8) in the protein data bank. The gold protein is the Cas9 endonuclease, the guide RNA is green, and the DNA is purple. The pdb data only includes the targeted portion of the DNA, so I added the leading and trailing portion DNA strand, and the loose unbound half is my best guess as to where it goes while the target DNA is bound to the guide RNA. I’m interested in doing more images or animations of this process, so if you can see something I’m doing wrong, please let me know in the comments.
tRNA Friday: Scientific Illustration
Transfer RNAs carry amino acids to ribosomes, where they are strung to together to form proteins. This one was modeled using popsicle sticks, ping pong balls pdb 4TNA.
Sketchfabtastic! Medical Animation
Hemoglobin
by johnliebler
on Sketchfab
I’ve just discovered Sketchfab, a really cool website that allows you to post and view 3D models online, and I had to try it out. Here is the hemoglobin from last week’s render (pdb 1GZX), but with the protein backbone and oxygen-binding hemes (the bright yellow bits that look like dreamcatchers) exposed. The cool part is that you can interact with the object in real time. Rotate with the left mouse button, zoom with the scroll wheel, pan with the right mouse button. reset the view with the spacebar. Try it!
Sketchfab isn’t the only site like this, I also tried Verold and p3d, but I had issues with both of those, and Sketchfab was really easy to set up and use. Sketchfab supported the widest variety of 3d objects. The Lightwave3D files I work with are supported natively, while the others were more restrictive, and in the case of Verold, wouldn’t upload my objects in any format. I wish there were a few other features available, such as incidence-based shading and animation, but for now Sketchfab is still a really cool way to share and explore 3D objects.
Antibody
by johnliebler
on Sketchfab
Let it Bleed… Scientific Illustration of Hemoglobin
Over the past six months or so, my wife and I have been working our way through Dexter on Netflix, and we finally got to the series finale last night. So, as tribute to our friendly neighborhood serial killer, here’s some blood, or at least hemoglobin, which is the protein in red blood cells that carries oxygen throughout our bodies. As long as we avoid ending up Dexter’s table.
This model is based on pdb 1GZX.
Voronoi Spheres: Scientific Illustration
Just a test this week. I’m experimenting with voronoi modeling techniques. I was inspired in part by the structure of Cancellus (spongy) bone, but just as much by this fantastic Voronoi Yoda.
Well, You Can Tell by the Way I Use My Walk… Scientific Illustration
As my workload allows, I plan on spending some time revisiting many of the subjects from The Inner Life of the Cell, and where better to start than with a new version of this guy.
The kinesin motor protein was a real scene stealer in Inner Life, although it wasn’t even in the original treatment for the short. The original plan was to omit the motor protein in the vesicle shots, but when I saw Graham Johnson’s animation of the way a Kinesin takes a step from April 2000 (below), I secretly went ahead and modeled one of my own, animated a walk cycle for it, and added it into the vesicle shot. After I showed it to Dr. Viel, it not only got into the animation, it got several more shots as well.
Now everyone’s got a kinesin in their animation, most recently, the sparkly star stuff ones seen in episode 2 of the new COSMOS.
But, my favorite kinesin animation has to be this one, by the Hoogenraad lab at the Utrecht University, and not just because they named the kinesin after me. (Not really, but it’s a fantastic animation just the same.) Check it out.
Animated GIF of Kinesin Protein walking.
©John Liebler. All rights reserved. Contact for licensing.
Antibodies Are Go! Scientific Illustration
That Spells DNA! Scientific Illustration
Today is DNA Day. From Wikipedia:
DNA Day is a holiday celebrated on April 25. It commemorates the day in 1953 when James Watson, Francis Crick, Maurice Wilkins, Rosalind Franklin and colleagues published papers in the journal Nature on the structure of DNA. Furthermore, on that day in 2003 it was declared that the Human Genome Project was very close to complete. “The remaining tiny gaps are considered too costly to fill.”
They probably just filled it in with frog DNA. What could possibly go wrong?
Anyway, here’s a render of some DNA that I made just for the occasion. the structures come from pdb 1AOI. in this pdb the dna is coiled around a histone, as it would be when it is all packed into the nucleosome, but I’ve omitted the histone in this render. It’s not Histone Day after all.
also Jonathan Coulton will teach you how to spell DNA.
Packing it in: Scientific Animation of Protein Packing
Congratulations to my former colleagues at XVIVO. They have released the latest installment of The Inner Life of the Cell, and it’s a mind-blowing ride! Boasting a level of detail that I could only dream of in 2004 (when Inner Life began) “Protein Packing” sets out to update and correct a lot of things that were first shown in The Inner Life of the Cell, almost ten years ago. What can I say, it was a long time ago, a crazy time when we believed the world was flat, Revenge of the Sith was a good Star Wars movie, and kinesin proteins strutted around our cells like John Travolta on Saturday night.
Carl Zimmer does a great job comparing the animations, then and now, in his article in the New York Times, here, so I won’t get into that.
I’d like to take a moment to give credit, where it is richly deserved, to the animator Mike Smith, who, along with Helena Martin and Tony Bexley are the incredibly talented artists responsible for everything you see onscreen in “Protein Packing”. Making one of these animations is an enormous task. It takes it’s toll on the animator charged to manifest the mountain of science and data into an aesthetically pleasing whole. Mike’s care and attention to detail are ultimately what got those proteins to shake and move together and put a new level of understanding on the screen.
Like me, Mike has moved on from XVIVO, but I will be watching out for whatever he does next, it will probably be amazing.
Scientific Illustration: It’s time to leave that capsid…if you dare.
My friend Justin Paglino is an Associate Research Scientist in Neurosurgery at Yale. I was talking to him after band practice the other day (he’s also a ridiculously talented singer-songwriter-multi-instrumentalist), and it turns out he’s an expert on the parvovirus. So, to try and get my head around what he does, I looked up his little friend, and made a render of it. Or at least its capsid.
Viruses are just so damn cool, because they really look like little geometric space capsules, which, in fact, they kind of are. Only instead of astronauts or monkeys, they carry the virus’s DNA into the host cell’s nucleus where they pull off a bit of bio-espionage and convert the replication machinery inside to their own nefarious purposes. How cool is that? I mean unless you’re the host, in which case, it’s a little rude.
If you’re playing along at home, I started with pdb 1s58 from the Protein Data Bank
In the Beginning There Was The (Inner Life of the) Cell
John Liebler – The Inner Life of the Cell from John Liebler on YouTube.
I make my living creating art and animation of the beautiful and often surreal world that exists within our living (and sometimes dying) cells. Although I’ve been doing it since the late 90s, It was in 2006 that The Inner Life of the Cell brought my work to the widest audience on Earth: Youtube.
Originally planned as a classroom tool, Inner Life takes the viewer through many of the inner workings of a leukocyte (or white blood cell) showing many of the cellular structures and organelles along the way. I spent about a year and a half creating about eight and a half minutes of animation under the guidance of Dr. Robert Lue and Dr. Alain Viel. As the footage was rendered, we started to get a feeling that this was something special.
When it was finished, I thought that the visuals could stand on their own to show the wonder of the cellular landscape, even without labels or explanation. So I made the three minute edit, and asked Matt Berky (Massive Productions) to set it to music. I submitted it to the 2006 Siggraph Computer Animation Festival, where it was shown in the Electronic Theater.
It ended up on Youtube.
And took on a life of its own.
So, to kick things off on this blog, I’ve uploaded a fresh, clean version of the three minute, music-only version that was shown at SIGGRAPH in 2006, using the original uncompressed frames. Yes, it was originally 4:3 standard definition, and I have cropped the frame a bit to match modern aspect ratios, so purists may be offended, but It’s not like I made Greedo shoot first or anything.
The Inner Life of the Cell was Supported by the Howard Hughes Medical Institute and is Copyright © 2006 by the President and Fellows of Harvard College.
Golgi Apparatus. Copyright © 2006 The President and Fellows of Harvard College